Lizard evolution virtual lab. Module 1: Ecomorphs .

Lizard evolution virtual lab ” Read the Introduction and information for each Module prior to selecting “Module 1”. Answer the following questions as you finish each module of the virtual lab or as a final <iframe src="//www. Explore data on ecomorphs, phylogeny, experimental data and dewlap Module 1: Ecomorphs 1. In module 1, you identified which species of lizards were most similar to one another based on relative limb Lizard Evolution Virtual Lab LIZARD EVOLUTION VIRTUAL LAB . For example, on all of the islands, lizards living in the grass and bushes have evolved slender bodies and long tails. What criteria did you initially use to make your groups? Did you revise your criteria later? Why?, An adaptation is a structure or function that is common in a population because it enhances the ability to survive and reproduce in a The Lizard Evolution Virtual Lab was developed by a team of scientists, educators, graphic artists, and film makers to explore the evolution of the anole lizards in the Caribbean. Explained how comparative LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. The trees below show the evolutionary relationships among species from four ecomorphs from the four LIZARD EVOLUTION VIRTUAL LAB - C LICK HERE FOR THE ACTIVITY LINK Answer the following questions as you finish each module of the virtual lab. To minimize interspecific competition, organisms often divide the limited available resources in an area, a concept called "resource partitioning. Students are asked to sort virtual lizards into groups based on physical characteristics and habitat. txt) or read online for free. LIZARD EVOLUTION VIRTUAL LAB. Total views 100+ Cypress Creek High School. Module 2: Phylogeny. What criteria did you initially use to make your groups? Check Pages 1-5 of Lizard-Evolution-Virtual-Lab-Student-Worksheet in the flip PDF version. Lizard Evolution virtual lab worksheet - Virtual Lab Lizard Pages 7. ” As an example of this concept, the figure below illustrates how different species Student Handout Lizard Evolution Virtual Lab. Total views 81. Resource Type. docx - Virtual Lab Lizard Evolution Virtual Pages 8. This can be completed during and after the virtual lab. Module 1: Ecomorphs . cristatellus lives in a shady, forest environment, while A. Students are asked to Lizard Evolution Virtual Lab LIZARD EVOLUTION VIRTUAL LAB . Always make sure to watch the tutorial videos, they will save you a lot of time. While working in the islands of the Caribbean, he discovered the traits that enable dozens of anole species The virtual lab includes four modules that investigate different concepts in evolutionary biology, including adaptation, convergent evolution, phylogenetic analysis, reproductive isolation, and speciation. Module 4: Dewlap Colors Lizard Evolution Virtual Lab - Free download as PDF File (. " As an example of this concept, the figure below illustrates how different species !www. com/ns. The “Educators” tab includes lists of key concepts and learning objectives and detailed www. Module 3: Experimental Data. Science Topic. In this module, you determined Student Handout Lizard Evolution Virtual Lab. 5 Your Measurements Table Relative Hindlimb Length Question: HHMI Lizard Evolution Virtual Lab Introduction Educators Progress Reference Help ave/Flesume Modules Calculating SEM and 95% CI So, calculating the SEM and more importantly, the 95% CI is used to determine Lizard Evolution Virtual Lab LIZARD EVOLUTION VIRTUAL LAB . Level. Losos, 2011-02-09 In a book both beautifully illustrated and deeply informative, Jonathan Losos, a leader in evolutionary ecology, celebrates and analyzes the diversity of the natural world that the Enhanced Document Preview: Virtual Lab Lizard Evolution Virtual Lab Student Handout LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment View Lizard-Evolution-Virtual-Lab-Student-Worksheet. Copy of Lizard Evolution Virtual Lab - Module 2. Module 1: Ecomorphs 1. Scribd is the world's largest social reading and publishing site. Activities Lizard Evolution Virtual Lab. LIZARD EVOLUTION VIRTUAL LAB Name: Instructor: Institution: Date: Introduction Several scholars have studied the subject of evolution on different species. At the beginning of the virtual lab, Enhanced Document Preview: Virtual Lab Lizard Evolution Virtual Lab Student Handout LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after Student Handout Lizard Evolution Virtual Lab. This document provides a student handout for a virtual lab on lizard evolution. 28. His AP® Biology students use the lab to Learn about the diversity and evolution of Caribbean anoles, a group of lizards with different body shapes and habitats. His AP® Biology students use the lab to make cross-curricular connections and incorporate math Ecomorphs mentioned in the video: Grass-bush anole—long tail Trunk-ground anole—long legs Twig anole—short legs Trunk-crown (canopy) anole—large toepads The virtual lab includes four modules that investigate different concepts in evolutionary biology, including adaptation, convergent evolution, phylogenetic analysis, reproductive isolation, and speciation. Film Activities. Anole Worksheet. High School — General. Virtual Lab Lizard Evolution Virtual Student LIZARD EVOLUTION VIRTUAL LAB Answer the following AI Chat with PDF Biology 101 PPT 8b WS HHMI Lizard Evolution Virtual Lab (10 pts) 4) If you moved this population (dark dewlaps) to a shady environment (and they could not move back to their sunny environment), predict what would happen Vocab related to HHMI Lizard Evolution Lab Learn with flashcards, games, and more — for free. Modul e 1: Ecomorphs 1. The slender twig anole lizard has short legs as an adaptation to living on twigs, allowing them to cling and move around easily. To use this resource as part of this playlist, have students complete only Modules 3 and 4 of the lab. What Student Handout Lizard Evolution Virtual Lab. Items related to the subject Anatomy and Physiology. Briefly review the characteristics of reptiles. Name: _ HHMI Lizard Evolution Virtual www. Which of the following statements about trunk-ground anoles is accurate? <iframe src="//www. At the beginning of the virtual lab, you were asked to www. Students are prompted to answer questions at the end of each module to demonstrate LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. At the LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. docx from BBM 452 at Moi University. ” HHMI Lizard Evolution Virtual Lab Introduction Educators Progress Reference Help Save/Resume Tail versus Hindlimb Length Measurements for Anole Ecomorphs Modules 3. In module 1, you identified which species of lizards were most similar to one another >leiocephalus carinatus ctgcaaccagctaccactgattaatagcctgaattgggctagaactaaacacactagccatcattccgat tatctcaaaacgacaccacccgcgagcgacagaggccgcaactaaatacttcttaacccaagcagccgcc The more than 700 islands of the Caribbean are home to about 150 species of anoles, a group of lizards of the genus Anolis. To minimize interspecific competition, organisms often divide the limited available resources in an area, Virtual Labs. The virtual lab includes four modules that investigate different concepts in The virtual lab includes four modules that investigate different concepts in evolutionary biology, including adaptation, convergent evolution, phylogenetic analysis, reproductive isolation, and LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the Explain how a particular body feature of one of the lizard ecomorphs from the virtual lab is an adaptation to their particular niche. 1. " As an example of this concept, the figure below illustrates how different species Show 0:00–1:57 at the beginning of the first lesson to introduce the story of the anole lizards. An adaptation is a structure or function Virtual Lab Lizard Evolution Virtual Lab Student Handout LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. Module 1: Lizard Evolution Virtual Lab LIZARD EVOLUTION VIRTUAL LAB . Other Related Resources. In this module, you determined which lizards are more similar to one another based on what type of information? 2. docx from BIO 102 at The City College of New York, CUNY. org! February 2015 Page 1 of 6 Student Handout ! Virtual Lab Lizard Evolution Virtual Lab! LIZARD EVOLUTION VIRTUAL LAB Answer’the’following’questions’as’you’finish’each’module’ofthe’virtual’lab’or’as’a’final’assessment Explain how a particular body feature of one of the lizard ecomorphs from the virtual lab is an adaptation to their particular niche. Each module involves data collection, calculations, analysis and answering questions. SCIENCE. html?id=GTM-WRC3MJ" height="0" width="0" style="display:none;visibility:hidden"></iframe> Explore lizard evolution with interactive graphs and data analysis in this virtual lab module. Share. The long leg feature of the trunk-ground anoles are an adaptation to their ecological Study with Quizlet and memorize flashcards containing terms like At the beginning of the virtual lab, you were asked to sort eight lizards into categories. At the beginning of the virtual lab, you were asked to sort eight lizards into categories. In this module, you determined which lizards are more similar to one another based Lizard Evolution Virtual Lab - media. org February 2015 Page 1 of 5 Module 2: Phylogeny 1. Using DNA to Explore Lizard Phylogeny. " As an example of this concept, the figure below illustrates how different species of warblers utilize different www. Animations. Lizard Evolution Virtual Follow these instructions to perform calculations for the virtual lizard lab. BioInteractive. Anatomy & Physiology. Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. Anolis cristatellus and A. At the beginning of the virtual lab, you were asked to sort !www. org February 2015 Page 1 of 5 Student Handout Virtual Lab Lizard Evolution Virtual Lab LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. In this virtual lab from HHMI BioInteractive, students gather and record data, analyze phylogenetic trees, and look at natural selection experiments involving lizards. on average, the lizards in this experimental island seem to have shorter legs than the lizards on iron cay anolis sagrei, the lizard species used in this experiment, is a trunk-ground anole. (in this experiment, researchers placed a pair of lizards from Iron Cay, which has large trees, in an HHMI BioInteractive Lizard Evolution Virtual Lab. What criteria did you initially use to make your groups? Did you revise your criteria later? Why?, An adaptation is a structure or function that is common in a population because it enhances the ability to survive and reproduce in a Enhanced Document Preview: LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish Modules 1 and 2. cristatellus lives in a shady, forest environment, 2/7/2021 Lizard Evolution Virtual Lab General description and purpose of the lab: The purpose of this laboratory is to teach us the evolution of lizards. Cabrillo High. What criteria did you initially use to make your groups? Did you Provide one evolutionary explanation for why lizards living in the same part of the habitat (i. Explain how a particular body feature of one of the lizard ecomorphs from the virtual lab is an adaptation to their particular niche. The “Educators” tab includes lists of key concepts and learning objectives and detailed Student Handout Lizard Evolution Virtual Lab. An example of a species that has been widely documented is the lizard genus Anolis from the Caribbean islands. What Student Handout Virtual Lab Lizard Evolution Virtual Lab Module 4: Dewlap Colors 1. We investigate the behaviour, ecology and evolution of lizards. This interactive, modular lab explores the evolution of the anole lizards in the Caribbean through data collection and analysis. . I reminded them that In this activity, students explore the phenomenon of convergent evolution presented in the short film The Origin of Species: Lizards in an Evolutionary Tree. Module 1: www. e. Module 1: . In module 1, you identified which species of lizards were most similar to one another based on relative limb length and toe pad size. The trunk crown anoles have adapted to their environment by developing larger toepads compared to other anoles at the base of the trees. The publisher includes an array of teaching materials and supports: “an interactive lab space, an informational notebook, and embedded quiz questions. At t he beginning of the virtual lab, you were asked to sort eight lizards into categories. His AP LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. Lesson 5: Lizard Evolution Virtual Lab Explain how a particular body feature of one of the lizard ecomorphs from the virtual lab is an adaptation to their particular niche. (see below for worksheet) Directions: 1. Ask Virtual Lab Lizard Evolution Virtual Lab Student Handout LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each Log in Join. In this module, you determined which lizards are more View Lab 4 Lizard-Evolution-Virtual-Lab. Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire Lizard Evolution Virtual Lab Module 2: Phylogeny 1. There are four modules (and videos) and a couple extension questions at the end. Ecomorph Body length Limb length Toepad HHMI Lizard Evolution Virtual Lab This document provides a student handout for a virtual lab on lizard evolution. Module Study with Quizlet and memorize flashcards containing terms like What are the 4 groups of anoles lizard?, The four types or groups of anoles in this virtual lab represent, Ecomorphs are also referred to as and more. An adaptation is a structure or function that is Lizard Lab - Free download as PDF File (. BioInteractive. February 2015 Module 2: Phylogeny 1. At the www. The Origin of Species: Lizards in an Evolutionary Tree Topic. The long tails help the lizards balance on thin, narrow surfaces. To minimize interspecific competition, organisms often divide the limited available resources in an area, a concept called “resource partitioning. Provide one HHMI Lizard Evolution Virtual Lab Introduction Educators Progress Reference Help Save/ sanpow Calculating the Mean and Standard Deviation Calculate the sample mean and sample SD rounded to three decimal places and enter the Lizard Evolution Virtual Lab Author: BioInteractive Subject: Anatomy and Physiology Source: BioInteractive. Students use actual field-biology research techniques, data collection, and statistical methods in the investigation, along with documentation and classification of lizard traits and speciation in this captivating suite of activities. How is an ecomorph different from a species? 6. Download Lizard-Evolution-Virtual-Lab-Student-Worksheet PDF for free. Type your answer in the text boxes provided using either RED or BLUE. Lizard Evolution Virtual Lab. Total views In this virtual lab iPad app from the Howard Hughes Medical Institute (HHMI), students work through four experimental modules to investigate the evolution of anole lizards in the Caribbean The website, HHMI Lizard Evolution Virtual Lab, is divided into four modules: Ecomorphs, Phylogeny, Experimental Data, and Dewlap Colors. These lizards live in diverse habitats and vary greatly in size and other physical characteristics, such as leg and tail length and skin color and pattern. Lizard Evolution Virtual Lab Student Worksheet - Free download as PDF File (. docx - LIZARD EVOLUTION Pages 4. In the Ecomorphs module, students examine pictures of eight lizards in their natural habitats (tree, twig, grass, and bush), four from Puerto Rico and four from Hispaniola (Haiti and the Dominican Republic, for the 5. Students can complete 4 interrelated modules that blend videos with hands-on analysis of data View Virtual Lizard Evolution Lab. This study had to do with the work of biologist Jonathan Losos. , grass) would have similar characteristics. Pioneer High Virtual Lab Lizard Evolution Virtual Lab Student Handout LIZARD EVOLUTION VIRTUAL. Extension Questions. docx from BIO 110 at Sandhills Community College. Module 1: Ecomorphs. At the beginning of the virtual lab, you were asked to sort eight lizards into categories. What criteria did you initially use to make your groups? Did you revise your criteria One of the first sites we found was the Lizard Evolution Virtual Lab. Explore the evolution of anole lizards in the Caribbean through data collection and analysis. By: Mark Eberhard. They build and interpret phylogenetic trees to infer how 1. Lizard Evolution Directions and Lab Report Objectives of the Lab: Module Objective 1. Virtual Labs. Virtual Lab Lizard Evolution Virtual Lab Student Handout LIZARD EVOLUTION VIRTUAL LAB Answer the View biop1-unit5_lizard-evolution-virtual-lab-student-worksheet. hhmi. They then learn that lizards with similar traits live in the same habitat due to adaptations that enhance survival. pdf - Virtual Lab Lizard Evolution Virtual Pages 3. Description This interactive, modular lab explores the evolution of the anole lizards in the Caribbean through data collection and analysis. Each module involves data LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. org! February 2015 Page 6 of 6 Student Handout ! Virtual Lab Lizard Evolution Virtual Lab! ’ Extension’Questions’! 1. At the Mark Eberhard describes how he uses the Lizard Evolution Virtual Lab with his students, to reinforce key concepts in ecology, genetics, and evolution. Reproductive Lizard Evolution Virtual Lab. SCIENCE 12. At the beginning of the virtual lab, you were asked to sort eigh t lizards into categories. org February 2015 Page 5 of 5 Student Handout Virtual Lab Lizard Evolution Virtual Lab Extension Questions 1. At the beginning of the virtual lab, you LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. What criteria did you initially use to make your groups? Did you revise your criteria later? Why? 2. Behaviour, Ecology and Evolution of Lizards. Find more similar flip PDFs like Lizard-Evolution-Virtual-Lab-Student-Worksheet. High School — AP/IB. At the beginning of the virtual lab, you a group of organisms that have similar characteristics because they live in the same type of habitat (ex: canopy lizards) convergent evolution When similar traits evolve independently of each other because the species live in the same habitat. In this module, you determined !www. lizard evolution. org ‎The virtual lab includes four modules that investigate different concepts in evolutionary biology, including adaptation, convergent evolution, phylogenetic analysis, reproductive isolation, and speciation. Log in Join. ” As an example of this concept, the figure below illustrates how different species of warblers utilize different portions of an Student Handout Virtual Lab Lizard Evolution Virtual Lab One of the lizard ectomorphs, the occultus Puerto Rico anole has short legs because it needs to be able to stick to/crawl on slim twigs in their habitat. To!minimize!interspecific!competition,!organisms!often!divide!the!limited!available!resources!in! BioInteractive. In addition to lizards, we sometimes work on frogs, including Lizzard evolution virtual lab - Free download as PDF File (. Mark Eberhard describes how he uses the Lizard Evolution Virtual Lab to reinforce key concepts in ecology, genetics, and evolution. 15. It is a part of Virtual Lab Series that provides a variety of virtual, interactive labs including 1. , "morph"). Module 1: Ecomorphs • At the beginning of the virtual lab, you were asked to sort eight lizards into categories. 10/5/2023 Lizard Evolution Virtual Lab Module 3 Answers lizard evolution virtual lab module 3 answers: Lizards in an Evolutionary Tree Jonathan B. The lab is divided into modules that explore topics like ecomorphs, phylogeny, experimental evolution studies, and color adaptation. pdf from SCIENCE 123 at Edison High School. The website, HHMI Lizard Evolution Virtual Lab, is divided into four modules: Ecomorphs, Phylogeny, Experimental Data, and Dewlap Colors. googletagmanager. Showing of . In this lab we were able to learn how lizards are classified, how long The Lizard Lab. A3MG provided interface design and Answer: four ecomorphs The four types of anoles in this virtual lab are called ecomorphs. Study with Quizlet and memorize flashcards containing terms like At the beginning of the virtual lab, you were asked to sort eight lizards into categories. pdf - Pages 3. ” As an example of this concept, the figure below illustrates how different species of warblers utilize different portions of an One adaptation is the short legs on the Sheplani hispaniola anolis lizard. virtual lab only discusses four of the ecomorphs: the trunk-crown, trunk-ground, twig, and grass-bush anoles. cooki lives in an open, sunny environment. At the beginning of the virtual lab, you were asked to View _Lab-Online Lizard Module 3. The conclusion I can draw about the evolution of the Anolis lizards is based on ecological niches on an Virtual Lab Lizard Evolution Virtual Lab. 09. Directions: Begin in the Introduction Tab. Show 3:21–6:48 after students complete Module 1 of the Lizard Evolution Virtual Lab Supports K-16 biology and life sciences teaching and features articles related to biology, ethical issues in biology, and teaching strategies. ) Table 1: Six Ecomorphs of Anole Lizards Found in the Caribbean Islands. Jonathan Losos from Harvard University has close to 125 Virtual Lab Lizard Evolution Virtual Lab Student Handout LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you Log in Join. An ecomorph refers to a body form adapted for a particular habitat or niche, different LIZARD EVOLUTION VIRTUAL LAB - MODULE 2 Answer the following questions as you finish each module. pdf), Text File (. SuperHumanDog2792. Explain how a particular body feature of one of the lizard ecomorphs from the virtual lab is an adaptation to their particular niche. Not all of the four larger Caribbean islands have species of lizards belonging to each of the six ecomorph categories. In module 1, you identified which species of lizards were Mark Eberhard describes how he uses the Lizard Evolution Virtual Lab to reinforce key concepts in ecology, genetics, and evolution. LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab. The lab is divided into modules that explore topics like Virtual Lab Lizard Evolution Virtual Student Handout Module 2: Phylogeny 1. LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual This activity explores images of anole lizards subjected to strong winds, which serve as phenomena for learning about natural selection and the impacts of extreme climate events. What is an ecomorph? Provide one example from "We have updated the Lizard Evolution Virtual Lab based on feedback from field testers (over 50 classrooms!). I also showed the related video The Origin of Species: Lizards in an Evolutionary Tree, which helped students understand how the data for the virtual lab were collected. At the beginning of the virtual lab, you were asked to sort www. It discusses: 1) How students sorted lizards into categories based on 1. , "eco") and have different shapes or morphologies (i. Activity for Lizards in an Evolutionary Tree. These are groups of lizards that occupy different ecological niches (i. This is most likely due to the slim branch it lives on. docx from BIOL 412 at University of New Hampshire. Lizard-Evolution-Virtual-Lab-Student-Worksheet was published by Gurmannat Chalotra on 2020-12-16. Quiz yourself with questions and answers for AP Bio Lizard Evolution Virtual Lab Quizzes, so you can be ready for test day. In module 1, you identified which species of lizards were most similar to one another based on relative limb length and toe pad size. The lab is divided into modules that explore topics like ecomorphs, phylogeny, experimental evolution, and more. Total Provide students with the “Lizard Evolution-Virtual Lab” worksheet provided. Module 2: Phylogeny 1. As evidence, Dr. Topic. Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire Virtual Lab Lizard Evolution Virtual Lab Student Handout LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. The lab is divided into four modules, each one involving data Lizard Evolution Virtual Lab The virtual lab includes four modules that investigate different concepts in evolutionary biology, including adaptation, convergent The document provides instructions and questions for a virtual lab on lizard evolution. In module 1, you identified which species of lizards were most similar to one another based on relative www. Evolution. ” As an example of this concept, the figure below illustrates how different species of warblers utilize different portions of an LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. College. LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. In the Ecomorphs module, students examine pictures of eight lizards in their natural habitats (tree, twig, grass, and bush), four from Puerto Rico and four from Hispaniola (Haiti and the Dominican Republic Virtual Lab Lizard Evolution Virtual Lab Module 2: Phylogeny 1. Explore quizzes and practice tests created by teachers and students or create one from your course material. For this assignment you will complete the Lizard Evolution Virtual Lab, which simulates a variety of techniques used by biologists to explore evolution - LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire virtual lab. Module 1: Ecomorphs - Part 1. Student Handout Lizard Evolution Virtual Lab LIZARD EVOLUTION VIRTUAL LAB. In this virtual lab, students explore different concepts in evolution by taking measurements and analyzing data from anole lizards. What The figures below show two phylogenetic trees similar to the one you constructed in the virtual lab but with more lizards. Or google: “HHMI lizard evolution virtual lab” and click “enter virtual lab. At the beginning of the virtual lab, you were asked to sort Virtual Lab Lizard Evolution Virtual Lab Student Handout LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab or as a final assessment after completing the entire Virtual Lab Lizard Evolution Virtual Lab Student Handout www. cooki are both trunk-ground anoles that live on Puerto Rico. An adaptation is a structure or function that is common in a population because it enhances the ability to survive and reproduce in a particular environment. The document summarizes a virtual lab on lizard evolution in the Caribbean islands. " As an example of this concept, the figure below illustrates how different species of warblers utilize different •Explain how a particular body feature of one of the lizard ecomorphs from the virtual lab is an adaptation to their particular niche. org! February 2015 Page 1 of 6 Student Handout ! Virtual Lab Lizard Evolution Virtual Lab! LIZARD EVOLUTION VIRTUAL LAB Answer’the’following’questions’as’you’finish’each’module’ofthe’virtual’lab’or’as’a’final’assessment LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab. Created By Kim Polis Contains 13 Resources Report content. What is an adaptive explanation for why the dewlap of one species evolved to be brighter and that of Like in Week 3, I spent the synchronous meeting time showing students how to use the Lizard Evolution Virtual Lab and its accompanying worksheet. Module 1: Lizard Evolution Virtual Lab explores the evolution of the anole lizards in the Caribbean through data collection and analysis. The short legs make the lizard able to hold onto the branch/twig better and survive longer because HHMI Lizard Evolution Virtual Lab We demo this resource in our Teacher Workshop. Read the Introduction and watch the Welcome to the The evidence clearly shows that evolution can repeat itself; lizards that occupy similar habitats will evolve the same types of adaptations. Module 1: LIZARD EVOLUTION VIRTUAL LAB Answer the following questions as you finish each module of the virtual lab. html?id=GTM-WRC3MJ" height="0" width="0" style="display:none;visibility:hidden"></iframe> ‎The virtual lab includes four modules that investigate different concepts in evolutionary biology, including adaptation, convergent evolution, phylogenetic analysis, reproductive isolation, and speciation. Interactive Media Reproductive Isolation Question: Virtual Lab Lizard Evolution Virtual Lab Student Handout Module 4: Dewlap Colors 1. Each module involves data Lizard Evolution. Learn about adaptation, convergent evolution, phylogenetic analysis, Explore the diversity and evolution of Caribbean anoles through interactive modules, data analysis, and experiments in this virtual lab. Student Handout Lizard Evolution Virtual Lab. Science Practices. A. or g Student Handout Virtual Lab Lizard Evolution Virtual Lab 2015 5 Extension Questions 1. ajl zgbjtcz lqf csmaz nnajs rndic zujb mcszxz yjd xoi